ID: 1083615545_1083615549

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1083615545 1083615549
Species Human (GRCh38) Human (GRCh38)
Location 11:64024357-64024379 11:64024386-64024408
Sequence CCGTTGAGGGGGTCCTATGATTT CTTTACAGATGAGAAAATAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 90} {0: 3, 1: 34, 2: 423, 3: 2466, 4: 8266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!