ID: 1083623719_1083623724

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1083623719 1083623724
Species Human (GRCh38) Human (GRCh38)
Location 11:64061304-64061326 11:64061331-64061353
Sequence CCGTCTGCCCTTCCTTCACGCTG TCCGCCCCCAGCCCGCAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 459} {0: 1, 1: 0, 2: 3, 3: 46, 4: 460}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!