ID: 1083655163_1083655176

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1083655163 1083655176
Species Human (GRCh38) Human (GRCh38)
Location 11:64225999-64226021 11:64226050-64226072
Sequence CCAAGTCCCTGCTGCAGAGAGGG CCAAGGTCACACGGTCAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 335} {0: 1, 1: 1, 2: 10, 3: 49, 4: 422}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!