ID: 1083655853_1083655867

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1083655853 1083655867
Species Human (GRCh38) Human (GRCh38)
Location 11:64229323-64229345 11:64229369-64229391
Sequence CCAGTGCCGAGTTCTATGTCCAG CTGGGTCTTGGGAAGGTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 97} {0: 1, 1: 0, 2: 3, 3: 63, 4: 529}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!