ID: 1083656806_1083656823

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1083656806 1083656823
Species Human (GRCh38) Human (GRCh38)
Location 11:64234024-64234046 11:64234076-64234098
Sequence CCACACTTCGGGATCCCTATCCC CAACAGAGGCATCCTTCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 95} {0: 1, 1: 0, 2: 1, 3: 17, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!