ID: 1083663736_1083663739

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1083663736 1083663739
Species Human (GRCh38) Human (GRCh38)
Location 11:64263861-64263883 11:64263877-64263899
Sequence CCTGGGAGTGGCCGAGCTGGATG CTGGATGGCCCCGACTGAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 24, 4: 202} {0: 1, 1: 0, 2: 0, 3: 3, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!