ID: 1083673117_1083673122

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1083673117 1083673122
Species Human (GRCh38) Human (GRCh38)
Location 11:64310906-64310928 11:64310923-64310945
Sequence CCACTCTGAAGAACAGTGAGCCA GAGCCAGCCGGCCAGGGTGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 343} {0: 1, 1: 2, 2: 4, 3: 31, 4: 356}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!