ID: 1083741456_1083741465

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1083741456 1083741465
Species Human (GRCh38) Human (GRCh38)
Location 11:64713679-64713701 11:64713704-64713726
Sequence CCACCGGCTCCCGGACGCCATGC ACGGCGGCCCCGGCCCCGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 128} {0: 1, 1: 0, 2: 4, 3: 48, 4: 402}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!