ID: 1083765778_1083765787

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1083765778 1083765787
Species Human (GRCh38) Human (GRCh38)
Location 11:64840779-64840801 11:64840829-64840851
Sequence CCTGTCTGGCTGCGACTGAGCCC CAGTGTGACCATATGGAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 168} {0: 1, 1: 0, 2: 3, 3: 56, 4: 503}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!