ID: 1083777950_1083777964

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1083777950 1083777964
Species Human (GRCh38) Human (GRCh38)
Location 11:64903396-64903418 11:64903414-64903436
Sequence CCCCCTTCCACCCGGCCCCGGCC CGGCCCCAGCACCTGGGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 80, 4: 879} {0: 1, 1: 0, 2: 3, 3: 61, 4: 995}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!