ID: 1083799376_1083799382

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1083799376 1083799382
Species Human (GRCh38) Human (GRCh38)
Location 11:65037726-65037748 11:65037772-65037794
Sequence CCTTAACTCGAGTGTGCAGGTGT CTCCCTGAGCAATACATGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 37} {0: 1, 1: 0, 2: 0, 3: 8, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!