ID: 1083820741_1083820748

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1083820741 1083820748
Species Human (GRCh38) Human (GRCh38)
Location 11:65170075-65170097 11:65170104-65170126
Sequence CCCTGGGGAGCCACAGCTGGGTG GGACTCACTGGCAGAGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 341} {0: 1, 1: 0, 2: 6, 3: 36, 4: 318}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!