ID: 1083826896_1083826904

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1083826896 1083826904
Species Human (GRCh38) Human (GRCh38)
Location 11:65209044-65209066 11:65209097-65209119
Sequence CCCTGCCCCATCTTTCTACCCAA TTTTTACTTTGGACTAATTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 44, 4: 353} {0: 1, 1: 0, 2: 2, 3: 33, 4: 340}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!