ID: 1083855787_1083855797

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1083855787 1083855797
Species Human (GRCh38) Human (GRCh38)
Location 11:65392432-65392454 11:65392481-65392503
Sequence CCTGCACCCCGGTGACGGACATC AGTGGCCTCACACCTCTCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 49} {0: 1, 1: 0, 2: 2, 3: 13, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!