ID: 1083881114_1083881123

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1083881114 1083881123
Species Human (GRCh38) Human (GRCh38)
Location 11:65548711-65548733 11:65548759-65548781
Sequence CCTCACTCCTGCCATGCAGCCTG CCCCAAACTCACCTGGCCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 77, 4: 814} {0: 1, 1: 0, 2: 3, 3: 28, 4: 356}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!