ID: 1083893543_1083893557

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1083893543 1083893557
Species Human (GRCh38) Human (GRCh38)
Location 11:65608841-65608863 11:65608891-65608913
Sequence CCCAACCTCAGGTGATCTGCCCG CAGGCCACTGCACCTGGCCGAGG
Strand - +
Off-target summary {0: 679, 1: 9625, 2: 37630, 3: 74218, 4: 106059} {0: 1, 1: 1, 2: 14, 3: 128, 4: 1075}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!