ID: 1083894066_1083894083

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1083894066 1083894083
Species Human (GRCh38) Human (GRCh38)
Location 11:65611488-65611510 11:65611533-65611555
Sequence CCTTGCCTGCCCTTTACCACCAC CAGGGGAACTAGAGGGGAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 413} {0: 1, 1: 0, 2: 2, 3: 24, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!