ID: 1083896820_1083896824

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1083896820 1083896824
Species Human (GRCh38) Human (GRCh38)
Location 11:65624225-65624247 11:65624255-65624277
Sequence CCTGTCTACTTCTGCATCTGCTG ATCTGGCTGCTGGACGCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 309} {0: 1, 1: 0, 2: 0, 3: 12, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!