ID: 1083901761_1083901770

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1083901761 1083901770
Species Human (GRCh38) Human (GRCh38)
Location 11:65646752-65646774 11:65646788-65646810
Sequence CCGAGCTGCAGGCAGCGGGCTCA TGCGCGCGGCGCCCGGGGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 221} {0: 1, 1: 1, 2: 9, 3: 66, 4: 486}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!