ID: 1083904055_1083904064

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1083904055 1083904064
Species Human (GRCh38) Human (GRCh38)
Location 11:65658717-65658739 11:65658769-65658791
Sequence CCTTTCTGCACCTTGTCACACAG TGCCAGAGTTTCGGTTCACTCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 16, 4: 226} {0: 1, 1: 0, 2: 0, 3: 3, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!