ID: 1083922511_1083922520

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1083922511 1083922520
Species Human (GRCh38) Human (GRCh38)
Location 11:65788210-65788232 11:65788239-65788261
Sequence CCCACAGCGGAGGGCCAGGCCCG CTGGTGTACCCAGTTATTTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 136} {0: 1, 1: 0, 2: 1, 3: 10, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!