ID: 1083936640_1083936652

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1083936640 1083936652
Species Human (GRCh38) Human (GRCh38)
Location 11:65872938-65872960 11:65872965-65872987
Sequence CCCGGTCCCCCGCGGCGCCGCCA CCGCCTCCCGGCGCCGGACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 274} {0: 1, 1: 0, 2: 4, 3: 32, 4: 246}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!