ID: 1083941622_1083941634

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1083941622 1083941634
Species Human (GRCh38) Human (GRCh38)
Location 11:65899438-65899460 11:65899482-65899504
Sequence CCTTCCCTCCCCTGTCGACACGT AATGGGCACCTGCAGCCTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 147} {0: 1, 1: 0, 2: 3, 3: 31, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!