ID: 1083941968_1083941977

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1083941968 1083941977
Species Human (GRCh38) Human (GRCh38)
Location 11:65900624-65900646 11:65900661-65900683
Sequence CCTGACGTAGCTGCCCATACATG CCGCGCCCAGGTGGAGCCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 74} {0: 1, 1: 0, 2: 1, 3: 24, 4: 249}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!