ID: 1083950639_1083950652

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1083950639 1083950652
Species Human (GRCh38) Human (GRCh38)
Location 11:65953713-65953735 11:65953749-65953771
Sequence CCCAGCGCAAGCTGGAGGAGCTG GGGCTTCGGGAGGCCTGGTTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 27, 4: 284} {0: 1, 1: 0, 2: 2, 3: 38, 4: 609}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!