ID: 1083954968_1083954973

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1083954968 1083954973
Species Human (GRCh38) Human (GRCh38)
Location 11:65978076-65978098 11:65978116-65978138
Sequence CCTCAGTTTGTCTCTAGTGGGCA GCCTGGCAGGAGGGTCAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 108} {0: 1, 1: 0, 2: 2, 3: 32, 4: 330}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!