ID: 1083992864_1083992877

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1083992864 1083992877
Species Human (GRCh38) Human (GRCh38)
Location 11:66257711-66257733 11:66257740-66257762
Sequence CCCCCTCCGACGCCACCGAGGTA TCACCTTTAAGGCGGCGCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 52} {0: 1, 1: 0, 2: 0, 3: 0, 4: 25}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!