ID: 1084000139_1084000153

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1084000139 1084000153
Species Human (GRCh38) Human (GRCh38)
Location 11:66291730-66291752 11:66291783-66291805
Sequence CCAGCGGGGGCTTCTCGGGGACG GGCGGCGCCGCCGGTGCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 78} {0: 1, 1: 0, 2: 2, 3: 59, 4: 630}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!