ID: 1084014221_1084014242

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1084014221 1084014242
Species Human (GRCh38) Human (GRCh38)
Location 11:66369233-66369255 11:66369281-66369303
Sequence CCCAGGCCAGAGGGGGCTGGGGA CAGTAGGGCTGGGGGGCAGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 65, 4: 596} {0: 1, 1: 0, 2: 8, 3: 103, 4: 911}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!