ID: 1084046068_1084046078

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1084046068 1084046078
Species Human (GRCh38) Human (GRCh38)
Location 11:66568366-66568388 11:66568394-66568416
Sequence CCAGCAGCTCCGGGGACGGCGGC GGCCTGAAAGCTGGCGGCTCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 28, 4: 312} {0: 1, 1: 0, 2: 0, 3: 18, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!