ID: 1084074445_1084074457

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1084074445 1084074457
Species Human (GRCh38) Human (GRCh38)
Location 11:66762237-66762259 11:66762284-66762306
Sequence CCCGGCCGCAGAACACGCGCGCA GCACAGCCGGGGCGCCGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 33} {0: 1, 1: 0, 2: 1, 3: 28, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!