ID: 1084092607_1084092613

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1084092607 1084092613
Species Human (GRCh38) Human (GRCh38)
Location 11:66888490-66888512 11:66888512-66888534
Sequence CCAGCACAGAGGAGGCAAAGGGA AACTCCCACGGCGATGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 377} {0: 1, 1: 0, 2: 0, 3: 3, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!