ID: 1084093257_1084093265

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1084093257 1084093265
Species Human (GRCh38) Human (GRCh38)
Location 11:66893290-66893312 11:66893330-66893352
Sequence CCTAAGAGCCACTCCTGACAGAG ATCCCAGAAGGGCCCAGAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 140} {0: 1, 1: 1, 2: 0, 3: 25, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!