ID: 1084093257_1084093271

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1084093257 1084093271
Species Human (GRCh38) Human (GRCh38)
Location 11:66893290-66893312 11:66893340-66893362
Sequence CCTAAGAGCCACTCCTGACAGAG GGCCCAGAGACGGGGAGTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 140} {0: 1, 1: 0, 2: 5, 3: 33, 4: 330}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!