ID: 1084102303_1084102310

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1084102303 1084102310
Species Human (GRCh38) Human (GRCh38)
Location 11:66957881-66957903 11:66957902-66957924
Sequence CCTGCAGAGCTGAGCCACATCCA CAGTACGATGGGGACAACTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 223} {0: 1, 1: 0, 2: 0, 3: 8, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!