ID: 1084115633_1084115642

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1084115633 1084115642
Species Human (GRCh38) Human (GRCh38)
Location 11:67041552-67041574 11:67041573-67041595
Sequence CCTCAGGGATGGCATGGTACCCT CTGGAAGGGCGTAACAGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 404} {0: 1, 1: 0, 2: 1, 3: 13, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!