ID: 1084159786_1084159793

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1084159786 1084159793
Species Human (GRCh38) Human (GRCh38)
Location 11:67340907-67340929 11:67340958-67340980
Sequence CCTGGCCATGGCCAAATTATTTT GTAAAAGGTCTTTGAGCAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 424} {0: 1, 1: 0, 2: 0, 3: 23, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!