ID: 1084162017_1084162030

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1084162017 1084162030
Species Human (GRCh38) Human (GRCh38)
Location 11:67355227-67355249 11:67355266-67355288
Sequence CCCTGCGGAGTTAGTGATGGAAG ACCAGGGCTGGGAAGGGCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 75} {0: 1, 1: 0, 2: 5, 3: 74, 4: 662}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!