ID: 1084171035_1084171041

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1084171035 1084171041
Species Human (GRCh38) Human (GRCh38)
Location 11:67401264-67401286 11:67401279-67401301
Sequence CCCCATGGATACCTCCGGGGGCG CGGGGGCGCCTAGGCCTCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 34} {0: 1, 1: 0, 2: 0, 3: 8, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!