ID: 1084171470_1084171482

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1084171470 1084171482
Species Human (GRCh38) Human (GRCh38)
Location 11:67403115-67403137 11:67403164-67403186
Sequence CCTCAGAACTGGAAGTGGGCCTG AGCACTTTGGGAGGCTAAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 292} {0: 2398, 1: 119370, 2: 202468, 3: 127652, 4: 75874}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!