ID: 1084171674_1084171689

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1084171674 1084171689
Species Human (GRCh38) Human (GRCh38)
Location 11:67404097-67404119 11:67404122-67404144
Sequence CCTCCCCCCTCTGACCCCGCAGC GGCCCCAGGCTGGCCGGGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 62, 4: 739} {0: 1, 1: 0, 2: 5, 3: 74, 4: 653}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!