ID: 1084204417_1084204431

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1084204417 1084204431
Species Human (GRCh38) Human (GRCh38)
Location 11:67583690-67583712 11:67583742-67583764
Sequence CCGGGGCTGGGGCCGGCGGGAGT GCCGTGACTCAGCACTGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 514} {0: 1, 1: 0, 2: 0, 3: 13, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!