ID: 1084219165_1084219170

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1084219165 1084219170
Species Human (GRCh38) Human (GRCh38)
Location 11:67667050-67667072 11:67667066-67667088
Sequence CCAGACCTGGGCCAGGAGGGGTC AGGGGTCTAGAATTTGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 391} {0: 1, 1: 0, 2: 0, 3: 16, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!