ID: 1084273031_1084273040

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1084273031 1084273040
Species Human (GRCh38) Human (GRCh38)
Location 11:68039085-68039107 11:68039123-68039145
Sequence CCAGCAGCGGAGGCGCGGCGCGC AGTGCCCCTGCCGGGGTCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 173} {0: 1, 1: 0, 2: 1, 3: 19, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!