ID: 1084307882_1084307897

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1084307882 1084307897
Species Human (GRCh38) Human (GRCh38)
Location 11:68298664-68298686 11:68298706-68298728
Sequence CCCCTACCCACTCCTGCTAGAGC CTAGGACTCCACCAGGGAGCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!