ID: 1084325625_1084325635

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1084325625 1084325635
Species Human (GRCh38) Human (GRCh38)
Location 11:68398281-68398303 11:68398326-68398348
Sequence CCCCTCAGAGCACAGCTAGGGTG ATTCCCTCCCAGCTGGCAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 153} {0: 1, 1: 0, 2: 1, 3: 26, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!