ID: 1084331775_1084331785

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1084331775 1084331785
Species Human (GRCh38) Human (GRCh38)
Location 11:68434637-68434659 11:68434688-68434710
Sequence CCCAAAGTGCTGGGATTACAGGC CCTTTTATGAAGGACCTGCTTGG
Strand - +
Off-target summary {0: 215700, 1: 270647, 2: 186590, 3: 142154, 4: 223611} {0: 1, 1: 0, 2: 1, 3: 9, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!