ID: 1084375428_1084375437

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1084375428 1084375437
Species Human (GRCh38) Human (GRCh38)
Location 11:68773597-68773619 11:68773643-68773665
Sequence CCTGACCCCGGAGGAGCAGCTGC TGACATGAGCAGGCCAGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 27, 4: 291} {0: 1, 1: 4, 2: 91, 3: 287, 4: 735}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!