ID: 1084386757_1084386760

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1084386757 1084386760
Species Human (GRCh38) Human (GRCh38)
Location 11:68847949-68847971 11:68847971-68847993
Sequence CCAACACCAGGGCCAGGGCAGTC CTTGCTCCTGACCGCTGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 291} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!