ID: 1084399738_1084399747

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1084399738 1084399747
Species Human (GRCh38) Human (GRCh38)
Location 11:68936719-68936741 11:68936748-68936770
Sequence CCTCCTTCCCTCAATTCCCACGA GCGGGTCCACCAAATAGCCGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 22, 4: 279} {0: 1, 1: 0, 2: 0, 3: 3, 4: 37}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!